"Pioneer factor interactions and unmethylated CpG dinucleotides mark silent tissue-specific enhancers in embryonic stem cells".

Jian Xu *, Scott D. Pope *, Ali R. Jazirehi *, Joanne L. Attema ¹, Peter Papathanasiou ¹, Jason A. Watts ², Kenneth S. Zaret ², Irving L. Weissman ^{1, @}, and Stephen T. Smale *^{, @},

* Howard Hughes Medical Institute, Molecular Biology Institute, and Department of Microbiology, Immunology, and Molecular Genetics, University of California, Los Angeles, CA 90095;
¹ Institute of Stem Cell Biology and Regenerative Medicine, Departments of Pathology and Developmental Biology, Stanford University School of Medicine, Stanford, CA 94305-5323;
² Cell and Developmental Biology Program, Fox Chase Cancer Center, Philadelphia, PA 19111

^@ To whom correspondence may be addressed:
Irving L. Weissman, E-mail: irv@stanford.edu
Stephen T. Smale, E-mail: smale@mednet.ucla.edu

http://www.pnas.org/cgi/doi/10.1073/pnas.0704579104

In contrast to the above model, genome-wide analyses of histone modifications have suggested that, in ES cells, genes encoding regulators of early development are associated with bivalent chromatin domains that are poised for activation (7–10). In one model that is consistent with the accumulated data, genes encoding regulators of lineage commitment are poised in ES cells, but more typical tissue-specific genes are unmarked and assembled into silent chromatin structures as they await chromatin decondensation catalyzed  by pioneer factors. Nevertheless, active histone modifications were found within the B-lineage-specific '5 locus in ES cells, leading to the hypothesis that these modifications may be necessary for transcription competence (11, 12).

The current study began as an effort to understand the developmental regulation of a thymocyte-specific gene, Ptcra, with DNA methylation analyses used as one method for monitoring the epigenetic state of the locus. To our surprise, a selectively unmethylated window was found within a well studied thymocyte-specific enhancer in ES cells and hematopoietic stem cells (HSCs). An analysis of enhancers for other lineage-restricted genes suggested that the presence of unmethylated windows in ES cells is quite common and results from transcription factor binding. Most importantly, functional studies provided evidence that factor binding in ES cells may be essential for gene transcription in differentiated cell types.

Results and Discussion

DNA Methylation at the Ptcra Locus.

To study events that regulate a typical tissue-specific gene during embryogenesis, we used bisulfite
sequencing to monitor DNA methylation at the mouse Ptcra locus. Ptcra, which encodes a subunit of the pre-T cell receptor complex, is expressed almost exclusively in immature thymocytes (13). The Ptcra locus is located between two constitutively expressed genes that contain cytidine phosphate guanosine (CpG)-island promoters.
Between the CpG islands, the Ptcra enhancer and promoter are the only noncoding DNA regions that exhibit evolutionary conservation. Studies of transgenic mice have shown that these regions are sufficient for proper Ptcra regulation (13–16).

In primary mouse thymocytes, most CpGs within the Ptcra locus were heavily methylated. However, low methylation was observed at 18 CpGs within an 848-bp region spanning the Ptcra enhancer and at three CpGs close to the promoter (Fig. 1).

Fig. 1. Ptcra methylation in ES cells.

Fig. 1. Ptcra methylation in ES cells.

Ptcra DNA methylation profiles are shown for the CCE ES cell line, nonstimulated (NS) and PMA/ionomycin-stimulated (PI) thymocytes, spleen, and liver cells. Methylation levels are represented in a gradation of colors: dark green (0 –20%), light green (21– 40%), yellow (41–60%), orange (61–80%), and red (81–100%). The same data with the ratio values are shown in SI Fig. 16.

Upon transcriptional inactivation after thymocyte maturation, the methylation pattern was unchanged.

Surprisingly, when the mouse CCE ES cell line was examined, a clear unmethylated window was observed at the
Ptcra enhancer (Fig. 1), despite the absence of transcription [supporting information (SI) Fig. 6]. One of the unmethylated CpGs  ( -4,080) is within an Myb binding site shown to be critical for enhancer function (13, 14). As additional controls, DNA methylation was examined in total spleen and liver, revealing reduced methylation at the Ptcra enhancer in both tissues.

Ptcra Methylation in Hematopoietic and Nonhematopoietic Populations.

To characterize Ptcra methylation further, 16 additional cell populations were examined (Fig. 2), including an independent ES cell line (J1).

Fig. 2. The Ptcra enhancer contains unmethylated windows in numerous tissues.

(A) An alignment of the mouse (m) and human (h) Ptcra enhancer core
sequences. Previously identified transcription factor binding sites are boxes, and CpG locations are indicated. 

In both ES cell lines, low methylation (40% or less) was found within the Ptcra enhancer at several CpGs. Although variability was observed, similar variability was observed within the CCE line in independent experiments (SI Fig. 7).

After differentiation of the CCE ES cells into embryoid bodies (EB) (17), methylation increased at some CpGs within the Ptcra enhancer, but others remained largely unmethylated. In primary blastocysts, low methylation was found at a subset of the CpGs that exhibited low methylation in the ES cell lines (Fig. 2B).

Fig. 2. The Ptcra enhancer contains unmethylated windows in numerous tissues.

Fig. 2. The Ptcra enhancer contains unmethylated windows in numerous tissues.

(A) An alignment of the mouse (m) and human (h) Ptcra enhancer core sequences. Previously identified transcription factor binding sites are boxes, and CpG locations are indicated.

(B) Methylation profiles for the Ptcra enhancer and promoter in various cells and tissues. Results from a minimum of two experiments are shown for blastocysts, CCE ES cells, thymocytes, BMDM, and sperm cells.
Results obtained with the HSC, MPP, CLP, and CMP populations are also described in Attema et al. (40). The same data with the ratio values are shown in SI Fig. 17.

Methylation was also examined in purified HSCs (18). In HSCs, which do not express Ptcra (SI Fig. 6), low methylation (40% or less) was observed at several CpGs in the Ptcra enhancer (Fig. 2B). We also analyzed methylation in purified multipotent progenitors (18), common lymphoid progenitors (H. Karsunky and I.L.W., unpublished data, and ref. 19), and common myeloid progenitors (20) and observed profiles similar to the HSC profile. Finally, in bone marrow-derived macrophages (BMDM), muscle, brain, and sperm, methylation was absent at the CpG overlapping the Myb site (-4,080), with low methylation at a few other CpGs in most tissues.
These results demonstrate that the tissue-specific Ptcra enhancer possesses an unmethylated window in ES cells, HSCs, and all other tissues examined.

DNA Methylation at an Inducible, Tissue-Specific Il12b Enhancer.

We next examined an enhancer for Il12b, which encodes the p40 subunit of IL-12 and IL-23 (21, 22). The Il12b enhancer coincides with a 545-bp conserved region 10 kb upstream of the start site (Fig. 3A; -9,437 to -9,981) (22).

Fig. 3. The Il12b and Alb1 enhancers contain unmethylated windows.

Fig. 3. The Il12b and Alb1 enhancers contain unmethylated windows.

(A) Methylation of the Il12 enhancer and promoter in numerous cell types. Results are diagrammed as in Fig. 1. The ratio values are shown in SI Fig. 8.

(B) CpG methylation in the 300-bp Alb1 enhancer in numerous cell types.

(C) Results from five bisulfite sequencing experiments in CCE ES cells. The ratio values are shown in SI Fig. 9.

(D) DNA sequence of the Alb1 enhancer (-10,566 to -10,865).

(D) DNA sequence of the Alb1 enhancer (-10,566 to -10,865).
Transcription factor binding sites are marked above the sequences and CpGs are underlined.

Despite the above, all six CpGs within the enhancer were selectively unmethylated in resting BMDM (Fig. 3A and SI Fig. 8; -9,420 through -9,874). Remarkably, in the two ES cell lines, most of these CpGs were also unmethylated (Fig. 3A). The three CpGs closest to the promoter were unmethylated in BMDM, suggesting
that the gene is poised for activation. However, the promoter CpGs were mostly methylated in ES cells, consistent with the absence of Il12b expression.

DNA methylation at Il12b was examined in several other cell populations (Fig. 3A). The regions examined were largely unmethylated in total blastocysts, consistent with previous evidence of low overall methylation in blastocysts (2). It is not clear why methylation in blastocysts is lower at the Il12b locus than the Ptcra locus. In EB, the unmethylated window at the Il12b enhancer narrowed, reminiscent of the Ptcra results. The unmethylated window at the Il12b enhancer was also apparent in HSCs and the other populations examined, with brain exhibiting somewhat higher methylation than the other tissues. No CpGs in the Il12b enhancer were unmethylated in sperm.

An Unmethylated CpG at the Alb1 Enhancer.

We next examined the liver-specific Alb1 (albumin) enhancer (5, 6, 24). FoxA1 binding sites in this enhancer (Fig. 3D) are occupied in gut endoderm, leading to the hypothesis that FoxA1 acts as a pioneer transcription factor that promotes opening of the locus. However, the Alb1 enhancer had not been examined in ES cells.

Five CpGs spanning the Alb1 enhancer exhibited low methylation in liver, consistent with Alb1 expression in these cells (Fig. 3B and SI Fig. 6). The partial methylation probably reflects the fact that some cells in the liver preparation were not hepatocytes. Interestingly, in the two ES cell lines, one CpG in the Alb1 enhancer was
extensively unmethylated. This CpG, at -10,695, is located within one of two FoxA1 binding sites (Fig. 3D). An examination of the ES cells used for the bisulfite sequencing analysis revealed that the cells uniformly expressed two markers of pluripotent ES cells, Oct-4 and SSEA-1, ruling out the possibility that the low methylation was due to spontaneous differentiation (SI Fig. 9). In addition, comparable results were obtained in five independent analyses of CCE ES cells

(Fig. 3C). It is noteworthy that the methylation profile of this enhancer differs from those of the Ptcra and Il12b enhancers, because the Alb1 enhancer was fully methylated in most other tissues examined.

Protein–DNA Interactions at the Ptcra and Alb1 Enhancers.

A likely explanation for the presence of the unmethylated windows is that sequence-specific DNA binding proteins occupy the tissue-specific enhancers in ES cells. Dimethyl sulfate genomic footprinting experiments
with the Ptcra enhancer confirmed this prediction because clear regions of protection from modification were observed in ES cells, with a few nucleotides hypersensitive to modification (Fig. 4A; see also SI Fig. 10).

Fig. 4. Binding of transcription factors to the Ptcra and Alb1 enhancers in ES cells.

Fig. 4. Binding of transcription factors to the Ptcra and Alb1 enhancers in ES cells.

(A) In vivo protein–DNA interactions at the Ptcra enhancer region. DMS footprinting was performed with purified CCE ES cell DNA (lane 1), CCE ES cells (lane 2), EB cells (lane 3), Ptcra ⁺ VL3-3M2 thymocytes (lane 4), Ptcra^- PMA/ionomycin-treated VL3-3M2 cells (lane 5), and CCE ES cells without piperidine cleavage of methylated DNA (lane 6). Nucleotides consistently protected from methylation in ES cells (open circles) and nucleotides exhibiting enhanced methylation (filled circles) are shown. Potential transcription factor binding
sites are shown. Filled triangles mark the positions of CpGs (-3,997, -4,042, and -4,080). SI Fig. 10 shows the results of two additional experiments.

(B) Binding of FoxD3 to the Alb1 enhancer in ES cells. ChIP assays were performed with FoxD3 antibodies. Convergent arrows beneath the Alb1 map indicate PCR priming sites. Real-time PCR signals from control IgG ChIPs were subtracted, and the data were expressed as percent input values. Standard deviations from two replicate experiments are shown.

The nucleotides that were most clearly protected in ES cells are in close proximity to two E boxes and a CSL site [CBF-1, Su(H), Lag-1] (15). These results demonstrate that proteins occupy the Ptcra enhancer in ES cells, although the identities of the proteins remain unknown.

At the Alb1 enhancer, the CpG that is unmethylated in ES cells coincides with a binding site for FoxA1 (5, 6). FoxA1 is not expressed in ES cells (data not shown), but bioinformatics studies suggested that another Fox family member, FoxD3, may bind the enhancer. Furthermore, previous studies had suggested that FoxD3
contributes to a pluripotency network (25–27). Indeed, ChIP experiments demonstrated that FoxD3 interacts with the Alb1 enhancer in ES cells (Fig. 4B). FoxD3 binding may therefore be responsible for the unmethylated window, and pioneer interactions with the Alb1 enhancer may first occur in pluripotent cells rather than committed endoderm.

Histone Modifications at the Ptcra and Il12b Enhancers.

To determine whether the unmethylated windows coincide with histone modifications, ChIP experiments were performed. Peaks of histone H3-K9 acetylation and histone H3-K4 di- and trimethylation were observed at the Ptcra enhancer in ES cells (SI Fig. 11), but these modifications were not observed at the Il12b or Alb1 enhancers (SI Fig. 12 and data not shown). Peaks of histone H3-K27 trimethylation were not observed at any of the enhancers in ES cells (SI Figs. 11 and 12), despite the successful use of these antibodies in positive control experiments (SI Fig. 13). These results suggest that the unmethylated windows in ES cells coincide with common histone modifications at some, but not all, enhancers.

Enhancer Marks in ES Cells May Be Essential for Subsequent Transcription.

The above results provide compelling evidence that at least some silent tissue-specific genes in ES cells are not assembled into chromatin structures that render them inaccessible to transcription factor binding. However, the functional significance of the marks remains unknown. The ES cell marks could be necessary for the subsequent expression of the genes, could help keep the genes silent in pluripotent cells, or could have no
functional relevance.

To distinguish among these possibilities, we stably transfected Ptcra enhancer-promoter-GFP-insulator reporter plasmids into ES cells after premethylation with the SssI CpG methylase to eliminate the unmethylated windows (Fig. 5A and SI Fig. 14 A and D).

Fig. 5. ES cells but not thymocytes promote the loss of methylation at a premethylated plasmid

Fig. 5. ES cells but not thymocytes promote the loss of methylation at a premethylated plasmid. This diagram provides a summary of the results in SI Fig. 14.

(A) Methylation profile of the premethylated plasmid before transfection. Colors indicate methylation levels as described in the legend to Fig. 1.

(B) Methylation profiles for five ES cell clones transfected with the unmethylated Ptcra enhancer-promoter-reporter plasmid and seven ES cell clones transfected with the premethylated plasmid.

(C) Methylation profiles for eight VL3-3M2 clones transfected with the unmethylated plasmid and 20 VL3-3M2 clones transfected with the premethylated plasmid.

(D) Methylation profiles for four EL4 clones transfected with the unmethylated plasmid and six EL4 clones transfected with the premethylated plasmid.

Although the loss of methylation prevented us from performing the experiment that was originally envisioned, a surprising result was obtained when the experiment was repeated in the Ptcra-expressing VL3-3M2 thymocyte line. Although GFP reporter activity was readily detected when the unmethylated plasmid was stably transfected into this line (SI Fig. 15), the premethylated plasmid was resistant both to transcription and loss of enhancer methylation (Fig. 5C and SI Fig. 15). That is, although pluripotent ES cells do not express the full complement of factors required for Ptcra transcription, they express the factors and/or machinery required for the efficient loss of methylation from a premethylated Ptcra enhancer. In contrast, differentiated thymocytes express the factors required for Ptcra transcription, but they lack factors or machinery required for activation of a reporter plasmid in which the enhancer mark has been eliminated by in vitro methylation. Efficient
methylation remained intact in all VL3-3M2 clones from two transfection experiments and in all clones derived from transfection of a second thymocyte line (Fig. 5D; see also SI Fig. 14 G and H).

These results provide initial evidence that the enhancer marks in ES cells may be essential for subsequent expression of tissue-specific genes; these marks may be necessary because differentiated tissues may lack specific factors or machinery needed to activate an unmarked enhancer.

Conclusions

Our results show that a feature of pluripotent ES cell lines is the existence of unmethylated windows within the enhancers of typical tissue-specific genes. The binding of transcription factors appears to be responsible for the unmethylated windows. A central unanswered question is whether the unmethylated windows and underlying
protein–DNA interactions observed in ES cells are important for the proper regulation of tissue-specific genes. The protein–DNA interactions could be essential for subsequent transcription in differentiated tissues, or they could contribute to the silent state in ES cells. Alternatively, the marks may serve simply as diagnostic marks that could be useful for predicting the developmental potential of stem and progenitor cells.

The stable transfection results provide initial evidence that the enhancer marks may indeed be essential for subsequent transcription. ES cells, but not thymocytes, appear to possess factors or machinery required for the loss of methylation from a premethylated plasmid. The thymocytes may lack this capacity because the
DNA binding proteins required for endogenous Ptcra transcription in thymocytes may differ from the enhancer binding proteins present in ES cells. Alternatively, protein complexes that modulate chromatin structure may be fundamentally different in pluripotent versus differentiated cells. We favor this latter possibility based on
evidence that ES cell chromatin is generally less compact than chromatin in differentiated tissues (12).

Although the data support a model in which differentiated tissues may not be competent to activate a locus in the absence of preexisting enhancer marks, further studies are needed to establish the precise reason these marks exist. Previous studies have shown that differentiated cell lines are indeed capable of promoting the
loss of methylation at some premethylated tissue-specific enhancers (28, 29). Therefore, premethylation does not always induce the formation of an activation-resistant chromatin structure in differentiated cells. One notable difference between our studies and the previous studies, however, was the existence of f lanking b-globin insulator sequences in our plasmids, which may further restrict the loss of methylation. In the future, it will be necessary to devise a strategy that can erase enhancer marks at endogenous loci in differentiated tissues. At this time, we can only conclude that an enhancer capable of promoting the loss of DNA methylation in ES cells cannot promote the loss of methylation in cells that express the corresponding endogenous gene.

We must also consider the possibility that the unmethylated windows and underlying protein–DNA interactions at tissue-specific enhancers in ES cells help keep the genes silent. The histone modification results seem inconsistent with this hypothesis. However, it is noteworthy that the CSL site in the Ptcra enhancer
appeared to be occupied in the genomic footprinting experiments. CSL proteins are repressors in the absence of Notch signaling and activators when associated with the Notch intracellular domain (15, 30). Although this finding raises the possibility that the interactions observed in ES cells contribute to repression, the histone acetylation observed at the Ptcra enhancer is inconsistent with this hypothesis.

Although several previous studies of DNA methylation in early embryos have been performed, the existence of unmethylated windows in enhancers for tissue-specific genes was not observed for multiple reasons. First, the earliest studies relied on methylation-sensitive restriction enzymes, which provided information about only one or two CpGs in the vicinity of a gene. Another limitation is that most previous studies focused on primary embryos rather than ES cell lines. An examination of primary ES cells derived from blastocysts, without in vitro expansion, would clearly be preferable to ES cell lines. However, previous studies of DNA methylation during embryogenesis focused on total blastocysts, although pluripotent cells within blastocysts are restricted to the inner cell mass and the number of pluripotent cells within the inner cell mass remains unknown. The extent to which the methylation properties of ES cell lines are representative of primary ES cells will therefore remain unknown until primary ES cells are purified in sufficient quantities for methylation analysis.

Finally, it is important to consider the possible relevance of these enhancer marks to the pluripotency of ES cell lines. If the unmethylated windows and protein–DNA interactions observed at the Ptcra, Il12b, and Alb1 enhancers are truly essential for transcription in differentiated cells, the factors responsible for these marks may be required for full ES cell pluripotency. Because different DNA binding proteins are likely to be associated with different tissue-specific enhancers in ES cells, a large number of DNA binding proteins may contribute to pluripotency, although loss of any one factor may preclude the subsequent expression of a relatively small number of tissue-specific genes.

Materials and Methods

Cells.

Thymocytes and tissues were isolated from C3H mice (4–8 weeks old) as described in ref. 31. The VL3-3M2 and EL4 thymocyte lines and J774 macrophage line were maintained as described in refs. 32 and 33. Thymocytes were stimulated with PMA (7.5 ng/ml) and ionomycin (180 ng/ml) for 16–18 h. BMDM were
prepared as described in ref. 34. Mature spermand blastocysts were collected by using standard methods. Hematopoietic progenitors were purified from C57BL/6 bone marrow cells as described (refs. 18–20; H. Karsunky and I.L.W., unpublished data).

CCE ES cell lines and J1 were maintained on gelatin-coated Petri dishes in DMEM (Invitrogen, Carlsbad, CA) with 15% FBS (Gemini Bio-Products, West Sacramento, CA), 150 uM monothio-glycerol (MTG; Sigma–Aldrich, St. Louis, MO), and 1,000 units/ml leukemia inhibitory factor (Chemicon, Temecula, CA). ES cells were differentiated into EB for 6 days (17).

Bisulfite Sequencing.

DNA from preimplantation embryos was isolated as described in ref. 35. DNA from hematopoietic progenitor
cells (118,000–460,000 cells) was isolated by using a modified SDS/proteinase K protocol (36). DNA from cultured ES cells, EB, and tissues was isolated by using the DNeasy tissue kit (Qiagen, Valencia, CA). Preimplantation embryos were treated with bisulfite as described in ref. 35. DNA from adult tissues or cultured cells was treated with bisulfite as described in refs. 37 and 38 with modest modifications (see SI Materials and Methods). PCR of the bisulfite-treated DNA was performed by using specific primers (see SI Materials and Methods).

Plasmids and Stable Transfection.

A 0.37-kb Ptcra core enhancer fragment and a 0.5-kb promoter fragment were subcloned into the
NheI and BstBI sites of the reporter vector pd2EGFP (Clontech, Mountain View, CA), using PCR methods. A 1.2-kb chicken b-globin insulator was subcloned before the Ptcra enhancer and after the EGFP polyA site. Twenty-five to forty micrograms of the plasmid was linearized by XmnI digestion, followed by incubation
with 40–100 units of SssI (CpG) methylase (New England BioLabs, Ipswich, MA). Incubation was carried out overnight at 37°C in 400 ul of NEBuffer 2 (50 mM NaCl/10 mM Tris-HCl,pH 7.9/10 mM MgCl₂/1 mM DTT) and 160 uM S-adenosylmethionine, which was added every 4 h. The methylated DNA was extracted with phenol/chloroform, precipitated with ethanol, and dissolved in 50 mM Tris-HCl (pH 7.4). Efficient methylation was confirmed by bisulfite sequencing.

Linearized unmethylated or methylated plasmid (25–40 ug), together with 2 ug of a vector containing a neomycin-resistant gene (pQCIXN; Clontech), was used for each stable transfection. CCE ES cells were electroporated by using a Bio-Rad (Hercules, CA)

GenePulser II at 500 uFD, 0.24 kV. ES cell stable clones were selected in G418 (150 ug/ml) for 7–10 days; 20–40 colonies were transferred to 24-well plates for further culture. Positive clones containing the transgenes were verified by PCR and Southern blot. For stable transfection of VL3-3M2 and EL4 cells, 10⁷ cells were
electroporated by using a pulse of 960 uFD, 0.27 kV. After 48 h, cells were selected with puromycin (1 ug/ml), expanded, and screened as above.

Genomic Footprinting and ChIP.

Footprinting experiments were performed as described in ref. 39 with minor modifications (see SI Materials and Methods). ChIP of the Alb1 locus was performed by quantitative real-time PCR as described in the legend to SI Fig. 11, using FoxD3 antibody (Chemicon; catalog no. AB5687) and an IgG control (Upstate Biotechnology, Lake Placid, NY; catalog no. 12-370).

We thank Meisheng Jiang for isolation of blastocysts; Joseph Chan, Abe Chang, Kevin Doty, Wiam Turki-Judeh, and Wei Wu for technical assistance; Guoping Fan, Steve Jacobsen, and Boris Reizis for valuable discussions; and Caiyi Li, Rupa Sridharan, and Hilde Schjerven for critical reading of the manuscript.

This work was supported by National Institutes of Health Grants P01 DK53074 (to I.L.W.), R01 GM47903 (to K.S.Z.), and T32-AI07323 (to S.D.P.); a Mathers Foundation grant (to K.S.Z.); a California Institute of Regenerative Medicine Postdoctoral Fellowship (to J.L.A.); a C. J. Martin Postdoctoral Fellowship (to P.P.); and National Institutes of Health and National Research Service Award GM066367-05 (to J.A.W.). S.T.S. is a Howard Hughes Medical Institute Investigator.

References:

1. Hochedlinger K, Jaenisch R (2006) Nature 441:1061–1067.

2. Kafri T, Ariel M, Brandeis M, Shemer R, Urven L, McCarrey J, Cedar H, Razin A (1992) Genes Dev 6:705–714.

3. Jones PA, Takai D (2001) Science 293:1068–1070.

4. Reik W, Dean W, Walter J (2001) Science 293:1089–1093.

5. Gualdi R, Bossard P, Zheng M, Hamada Y, Coleman JR, Zaret KS (1996) Genes Dev 10:1670–1682.

6. Cirillo LA, Lin FR, Cuesta I, Friedman D, Jarnik M, Zaret KS (2002) Mol Cell 9:279–289.

7. Azuara V, Perry P, Sauer S, Spivakov M, Jorgensen HF, John RM, Gouti M, Casanova M, Warnes G, Merkenschlager M, Fisher AG (2006) Nat Cell Biol 8:532–538.

8. Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, et al. (2006) Cell 125:315–326.

9. Boyer LA, Plath K, Zeitlinger J, Brambrink T, Medeiros LA, Lee TI, Levine SS, Wernig M, Tajonar A, Ray MK, et al. (2006) Nature 441:349–353.

10. Lee TI, Jenner RG, Boyer LA, Guenther MG, Levine SS, Kumar RM, Chevalier B, Johnstone SE, Cole MF, Isono KI, et al. (2006) Cell 125:301–313.

11. Szutorisz H, Canzonetta C, Georgiou A, Chow CM, Tora L, Dillon N (2005) Mol Cell Biol 25:1804–1820.

12. Meshorer E, Misteli T (2006) Nat Rev Mol Cell Biol 7:540–546.

13. Reizis B, Leder P (1999) J Exp Med 189:1669–1678.

14. Reizis B, Leder P (2001) J Exp Med 194:979–990.

15. Reizis B, Leder P (2002) Genes Dev 16:295–300.

16. Gounari F, Aifantis I, Martin C, Fehling HJ, Hoeflinger S, Leder P, von Boehmer H, Reizis B (2002) Nat Immunol 3:489–496.

17. Keller G, Kennedy M, Papayannopoulou T, Wiles MV (1993) Mol Cell Biol 13:473–486.

18. Christensen JL, Weissman IL (2001) Proc Natl Acad Sci 98:14541–14546.

19. Kondo M, Weissman IL, Akashi K (1997) Cell 91:661–672.

20. Akashi K, Traver D, Miyamoto T, Weissman IL (2000) Nature 404:193–197.

21. Trinchieri G (2003) Nat Rev Immunol 3:133–146.

22. Zhou L, Nazarian AA, Xu J, Tantin D, Corcoran LM, Smale ST (2007) Mol Cell Biol 27:2698–2712.

23. Ramirez-Carrozzi VR, Nazarian AA, Li CC, Gore SL, Sridharan R, Imbalzano AN, Smale ST (2006) Genes Dev 20:282–296.

24. Chaya D, Hayamizu T, Bustin M, Zaret KS (2001) J Biol Chem 276:44385–44389.

25. Sutton J, Costa R, Klug M, Field L, Xu D, Largaespada DA, Fletcher CF, Jenkins NA, Copeland NG, Klemsz M, Hromas R (1996) J Biol Chem 271:23126–23133.

26. Tompers DM, Foreman RK, Wang Q, Kumanova M, Labosky PA (2005) Dev Biol 285:126–137.

27. Pan G, Li J, Zhou Y, Zheng H, Pei D (2006) FASEB J 20:1730–1732.

28. Kirillov A, Kistler B, Mostoslavsky R, Cedar H, Wirth T, Bergman Y (1996) Nat Genet 13:435–441.

29. Forrester WC, Fernandez LA, Grosschedl R (1999) Genes Dev 13:3003–3014.

30. Lai EC (2002) EMBO Rep 3:840–845.

31. Su RC, Brown KE, Saaber S, Fisher AG, Merkenschlager M, Smale ST (2004) Nat Genet 36:502–506.

32. Groves T, Katis P, Madden Z, Manickam K, Ramsden D, Wu G, Guidos CJ (1995) J Immunol 154:5011–5022.

33. Weinmann AS, Plevy SE, Smale ST (1999) Immunity 11:665–675.

34. Sanjabi S, Williams KJ, Saccani S, Zhou L, Hoffmann A, Ghosh G, Gerondakis S, Natoli G, Smale ST (2005) Genes Dev 19:2138–2151.

35. Millar DS, Warnecke PM, Melki JR, Clark SJ (2002) Methods 27:108–113.

36. Warnecke PM, Mann JR, Frommer M, Clark SJ (1998) Genomics 51:182–190.

37. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molloy PL, Paul CL (1992) Proc Natl Acad Sci 89:1827–1831.

38. Clark SJ, Harrison J, Paul CL, Frommer M (1994) Nucleic Acids Res 22:2990–2997.

39. Carey M, Smale ST (2000) Transcriptional Regulation in Eukaryotes: Concepts, Strategies, and Techniques (Cold Spring Harbor Lab Press, Cold Spring Harbor, NY).

40. Attema JL, Papathanasiou P, Forsberg EC, Xu J, Smale ST, Weissman IL, "Epigenetic characterization of hematopoietic stem cell differentiation using miniChIP and bisulfite sequencing analysis",  Pulished Online,  July 18, 2007, Proc Natl Acad Sci. (Open Access), http://www.pnas.org/cgi/content/abstract/0704468104v1?
 

Files in this Data Supplement:
SI Figure 6
SI Figure 7
SI Figure 8
SI Figure 9
SI Figure 10
SI Figure 11
SI Figure 12
SI Figure 13
SI Figure 14
SI Figure 15
SI Figure 16
SI Figure 17
SI Materials and Methods
 
 
 

SI Figure 6

Fig. 6. Distribution of lineage-specific gene expression. Expression of Ptcra, Il12b, Alb1, Oct4 and Gapdh is measured by quantitative RT-PCR in ESC lines (CCE and J1), primary thymocytes, the thymocyte cell line VL3-3M2, spleen, liver, bone marrow-derived macrophages stimulated with LPS for 4 h (BMDM-LPS4h), and brain. The relative mRNA expression is calculated from primer-specific standard curves using the iCycler Data Analysis Software. Error bars represent mean SD of three independent PCR amplifications. Ptcra expression in hematopoietic stem and progenitor cells measured by quantitative RT-PCR is described in Attema et al. (1).

1. Attema JL, Papathanasiou P, Forsberg EC, Xu J, Smale ST, Weissman IL,
"Epigenetic characterization of hematopoietic stem cell differentiation using miniChIP and bisulfite sequencing analysis",  Pulished Online,  July 18, 2007, Proc Natl Acad Sci. (Open Access), http://www.pnas.org/cgi/content/abstract/0704468104v1?

SI Figure 7

Fig. 7. Analysis of the reproducibility of bisulfite genomic sequencing. Bisulfite genomic sequencing is arguably the most widely used technique to detect 5-methylcytosine (5-MeC) in genomic DNA. This technique provides a quantitative measurement of DNA methylation at single-molecule resolution in any sequence context (2). The technique involves bisulfite conversion of genomic DNA, whereby unmethylated cytosine is converted to uracil, but 5-methylcytosine remains unchanged. The target sequence is PCR amplified using specific primers to yield fragments in which all uracil (converted from unmethylated cytosine) and thymine residues are amplified as thymine, and only 5-methylcytosine is amplified as cytosine. Following PCR amplification, methylated cytosines can be detected by direct analysis of the PCR products (3, 4, 5) or a more quantitative profile of methylation can be obtained by cloning the PCR fragments and sequencing individual clones, where each clone represents a single molecule in the DNA sample. In this study, we used the later approach to obtain quantitative measurements of CpG methylation in various cell types and tissues. The PCR fragments were TA-cloned into pCR2.1 vector (Invitrogen) and sequenced using M13 forward (-20) or reverse primers. The bisulfite genome sequencing method was first reported by Frommer et al. (6) and Clark et al. (3). Since that time, the validity of the method has been confirmed in a number of studies. However, as with any method, bisufite sequencing is associated with technical difficulties and potential artifacts (2). Incomplete bisulfite conversion, stochastic PCR amplification, PCR bias, and cloning bias are the major causes of artifacts that may complicate interpretation of bisulfite sequencing data. To address the problem of potential artifacts associated with PCR amplification and subsequent cloning of PCR fragments, and to determine whether we should attach any meaning to the variable results observed at a given enhancer when comparing a large number of different cell populations, we have extensively evaluated the reproducibility of bisulfite sequencing method using primers specific to the Ptcra enhancer and promoter regions and the Il12b enhancer region. Four independent bisulfite sequencing experiments were performed at each of these regions (Experiments 1-4) using genomic DNA isolated from ESC CCE cells. Experiments 1 and 2 were performed with independent PCR amplification, subcloning, and sequencing using the same genomic DNA preparation. Experiments 3 and 4 were performed using genomic DNA isolated from ESC CCE cells 10 months later. Similarly, bisulfite sequencing in primary thymocytes (NS, nonstimulated; PI, stimulated with PMA + ionomycin) and bone-marrow-derived macrophages (BMDM) were repeated twice (thymocytes 1 and 2) and three times (BMDM 1 to 3), respectively. In most cases, more than 10 clones were sequenced to estimate DNA methylation level. The combined results from the two, three, or four independent experiments are also shown. As shown in the color-coded table, the analyses from ESC CCE cells yield results with the same general trends, although the quantitative methylation values exhibit considerable variability in some instances. The windows of unmethylated CpG dinucleotides are readily apparent at both the Ptcra enhancer and Il12b enhancer in all four experiments. Nevertheless, specific variations were observed when the same genomic DNA sample was analyzed in two separate experiments (1 versus 2 and 3 versus 4) and also when different genomic DNA samples were analyzed (compare 1 and 2 with 3 and 4). In general, there appears to be greater variability at regions exhibiting intermediate levels of methylation (e.g., Ptcra -4,318, -4,292, and -3,965). The results obtained with thymocytes are more consistent, suggesting that the bisulfite sequencing method exhibits less variability if the CpGs analyzed are homogenously methylated or unmethylated in the population. In this case, the CpG dinucleotides within the amplified regions are nearly completely unmethylated. An example of the other extreme (nearly complete methylation) can be found at the Il12b enhancer regions (-9,512 and -9,420) in ESC CCE cells. The results obtained with bone marrow-derived macrophages support the general principles described above. That is, greater variability was observed at CpG dinucleotides that appeared to possess intermediate levels of methylation, whereas CpG dinucleotides that appeared to be fully methylated or unmethylated exhibited less variability. From these results, we conclude that the bisulfite genome sequencing method used in this study can generate reliable measurement of CpG methylation at multiple DNA regions. However, the results need to be evaluated with some caution. In particular, CpG dinucleotides that exhibit intermediate methylation levels may yield results that are relatively unreliable. For this reason, when modest variability in bisulfite sequencing results is obtained in a comparison of a number of different cell populations, as in this study, one cannot determine with confidence whether the methylation level at the endogenous locus is truly variable from cell type to cell type. Therefore, it is best to focus on general trends and relatively dramatic differences in the methylation profile when different cell samples are compared.

2. Warnecke PM, Stirzaker C, Song J, Grunau C, Melki JR, Clark SJ (2002) Methods 27:101-107.

3. Clark SJ, Harrison J, Paul C, Frommer M (1994) Nucleic Acids Res 22: 2990-2997.

4. Paul CL, Clark SJ (1996) Biotechniques 21:126-133.

5. Gonzalgo ML, Jones PA 91997) Nuclei Acids Res 25:2529-2531.

6. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molloy PL, Paul CL (1992) Proc Natl Acad Sci 89:1827-1831.

SI Figure 8

Fig. 8. The mouse Il12b enhancer contains a window of unmethylated CpG dinucleotides. The data shown in B of this figure are the same as in Fig. 3A but include the ratio values of methylated clones to total clones analyzed. (A) A diagram of the Il12b locus is shown. The coding regions and untranslated regions are shown as black and white boxes, respectively. The transcription start site (+1, arrow) was determined according to the published Il12b mRNA sequences (NM_008352). The enhancer (HSS1; 7) and promoter regions of the Il12b gene are marked. Regions selected for bisulfite sequencing are indicated by the two-headed arrows. (B) DNA methylation profiles are shown for the Il12b enhancer and promoter in various embryonic and somatic cells or tissues. Colors indicate methylation levels as described in the legend to Fig. 1.

7. Zhou L, Nazarian AA, Xu J, Tantin D, Corcoran LN, Smale ST (2007) Mol Cell Biol 27:2698-2712.

SI Figure 9

Fig. 9. The mouse Alb1 enhancer contains narrow windows of unmethylated CpG dinucleotides. The data shown in panels A and B of this figure are the same as in Fig. 3 B and C but include the ratio values of methylated clones to total clones analyzed. (A) DNA methylation profiles are shown for the Alb1 enhancer in various embryonic and somatic cells or tissues. (B) Results from five independent bisulfite sequencing experiments in ESC CCE cells are shown. (C) An aliquot of the cells (ESC CCE, EB, and VL3-3M2) used for bisulfite sequencing was stained with PE-conjugated mouse anti-SSEA-1 antibody and analyzed by flow cytometry. (D and E) Expression of Oct-3/4 and SSEA-1 is high in virtually all undifferentiated ESC and low in differentiated day-6 EBs, as shown by immunofluorescent microscopy.

SI Figure 10

Fig. 10. DMS genomic footprinting of the Ptcra enhancer region was performed multiple times to determine the validity of the results obtained. Two independent experiments analogous to the experiment in Fig. 4 are shown. Nucleotides protected from DMS modification or exhibiting enhanced modification are labeled as described in the legend to Fig. 4. Footprinting experiments were performed with ESC and EB, as well as with VL3-3M2 thymocytes (a transformed mouse double-positive thymocyte line [see main text]) that were either unstimulated (Ptcra+) or stimulated with PMA + ionomycin (Ptcra-). To identify background bands, the procedure was also performed with ESC but without the addition of piperidine to cleave adjacent to DMS-modified base-pairs.

SI Figure 11

Fig. 11. Analysis of histone modifications at the Ptcra locus. (A) The Ptcra locus was analyzed using chromatin prepared from non-stimulated (NS) and PMA + ionomycin-stimulated (PI) thymocytes, spleen, and liver cells. Antibodies directed against acetyl histone H3-K9, dimethyl H3-K4, and unmodified histone H3 were used. Precipitated DNA was quantified by real-time PCR using primer pairs specific to the indicated control regions relative to the Ptcra transcription start site. The abundance of each region was plotted relative to the input DNA (% INPUT). A diagram of the Ptcra locus is also shown at the top. (B) The Ptcra locus was analyzed by ChIP using chromatin prepared from the ESC (CCE) line. Antibodies were directed against acetyl H3-K9, dimethyl H3-K4, trimethyl H3-K4, trimethyl H3-K27, unmodified histone H3, and GST (as a negative control). Precipitated DNA was quantified and plotted as described above. The data are representative of experiments from three to five independent chromatin preparations.

SI Figure 12

Fig. 12. Analysis of histone modifications at the Il12b locus. (A) The Il12b locus was analyzed by ChIP using chromatin from nonstimulated (NS) and LPS-stimulated (LPS-4h) BMDMs. Antibodies directed against acetyl histone H3-K9, dimethyl H3-K4, trimethyl H3-K27, and unmodified histone H3 were used. Precipitated DNA was quantified by real-time PCR and was plotted relative to input DNA (% INPUT) as described in the legend to SI Fig. 11. A diagram of the Il12b locus is shown at the top. (B) The Il12b locus was analyzed by ChIP using chromatin from the ESC (CCE) line. Antibodies were directed against acetyl H3-K9, dimethyl H3-K4, trimethyl H3-K4, trimethyl H3-K27, unmodified histone H3, and GST (negative control). Precipitated DNA was quantified and plotted as described above. The data are representative of experiments from three to five independent chromatin preparations.

SI Figure 13

Fig. 13. Marks of active and repressed chromatin at promoters for tissue-specific genes and constitutively active genes. As controls for the experiments shown in SI Figs. 11 and 12, ChIP experiments were performed using chromatin prepared from undifferentiated ESC, primary thymocytes (T cells), and mature bone marrow-derived macrophages (BMDM). Antibodies directed against acetyl histone H3-K9 (Ac-H3K9), dimethyl H3-K4 (2Me-H3K4), trimethyl H3-K27 (3Me-H3K27), unmodified histone H3, and GST (as a negative control) were used. Precipitated DNA was quantified by real-time PCR, using primer pairs specific to the promoters of Oct4, Sox2, Math1, Sox1, Nkx2-2, Irx2, HoxA3, Ikaros, and Tnrc5 genes. The abundance of each region was plotted relative to the input DNA (% INPUT). The promoters for Math1, Sox1, Nkx2-2, Irx2, and Ikaros were found to be associated with both H3-K27 and H3-K4 methylation in undifferentiated ESC, as previously reported (8, 9). However, the HoxA3 promoter was associated with H3-K27 methylation, but not H3-K4 methylation. The promoter for the constitutively active gene Tnrc5 was associated with all active histone modifications, but not with H3-K27 methylation.

8. Azuara V, Perry P, Sauer S, Spivakov M, Jorgensen HF, John RM, Gouti M, Casanova M, Warnes G, Merkenschlager M, Fisher AG (2006) Nat Cell Biol 8:532-538.

9. Bernstein BE, Mikkelsen TS, Zie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, et al. (2006) Cell 125:315-326.

SI Figure 14

Fig. 14. Unmethylated windows emerge at the Ptcra enhancer following stable integration of premethylated constructs into ESC, but not thymocytes. The clone-by-clone data shown in this figure are summarized in Fig. 5. (A) A diagram of the Ptcra enhancer-promoter-GFP plasmid used for stable transfection assays is shown. The 369-bp enhancer and 511-bp promoter fragments from Ptcra were inserted upstream of a destabilized enhanced green fluorescent protein (EGFP) reporter (pd2EGFP; Clontech). A puromycin-resistant cassette was subcloned in the same construct. Two 1.2 kb chicken b-globin insulators were inserted upstream of the Ptcra enhancer and downstream of the EGFP polyA signal. The cloned Ptcra enhancer contains 7 CpG dinucleotides (-4,130 to -3,900). Putative transcription factor binding sites are shown as shaded boxes. Plasmids were linearized with XmnI, methylated with SssI CpG methylase, and electroporated into the ESC CCE line, VL3-3M2 double-positive thymocytes, and EL4 thymocytes, together with pQCIXN (Clontech) containing the neomycin-resistance gene. Unmethylated constructs were also electroporated separately as a control. Cells were selected with neomycin (ESC CCE) or puromycin (VL3-3M2 and EL4). Bisulfite sequencing analyses were performed with the premethylated plasmids and individual neomycin- or puromycin-resistant clones. (B) DNA methylation profiles are shown for five stable clones obtained following transfection of the unmethylated plasmid into ESC CCE cells. Each horizontal line represents an independently sequenced template with methylation at each CpG dinucleotide indicated by a filled circle. (C) Methylation profiles are shown for seven clones obtained following transfection of the premethylated plasmid into ESC CCE cells. (D) The methylation profile of the premethylated plasmid before transfection of ESC CCE cells is shown, confirming that CpG methylation by the SssI methylase was complete. (E and G) Methylation profiles are shown for eight VL3-3M2 clones and four EL4 clones transfected with the unmethylated plasmid. (F and H) Methylation profiles are shown for 20 VL3-3M2 clones and six EL4 clones transfected with the premethylated plasmid.

SI Figure 15

Fig. 15. GFP expression from unmethylated and premethylated insulator-Ptcra enhancer-promoter-reporter plasmids following stable transfection into ESC and VL3-3M2 cells. (A) GFP expression was monitored by flow cytometry in untransfected VL3-3M2 cells and in representative clones stably transfected with the unmethylated or premethylated insulator-Ptcra enhancer-promoter-reporter plasmid. (B) GFP expression was monitored by flow cytometry in untransfected ESC CCE cells and in representative clones stably transfected with the unmethylated or premethylated insulator-Ptcra enhancer-promoter-reporter plasmid.

SI Figure 16

Fig. 16. DNA methylation profiles of the Ptcra locus. (A) Diagram of the Ptcra locus and adjacent CpG island-containing genes. The transcription start site (arrows), coding regions (black boxes), untranslated regions (white boxes), and regions selected for bisulfite sequencing (two-headed arrows) are indicated. (B) Ptcra DNA methylation profiles are shown for the ESC CCE line, nonstimulated (NS) and PMA/ionomycin-stimulated (PI) thymocytes, spleen, and liver cells. The percent methylation at each CpG was calculated from the number of methylated clones divided by the total clones sequenced (also shown as a ratio). Methylation levels are represented in a gradation of colors: dark green (0-20%), light green (21-40%), yellow (41-60%), orange (61-80%), and red (81-100%). The data shown in B of this figure are the same as in Fig. 1 but include the ratio values of methylated clones to total clones analyzed.

SI Figure 17

Fig. 17. The mouse Ptcra enhancer contains windows of unmethylated CpG dinucleotides in sperm, blastocysts, ESC, HSC, hematopoietic progenitors, and non-hematopoietic tissues. The data shown in A of this figure are the same as in Fig. 2B, but include the ratio values of methylated clones to total clones analyzed. (A) DNA methylation profiles are shown for the Ptcra enhancer and promoter, as well as for the flanking CpG islands, in various embryonic and somatic cells or tissues. Only the first four CpG dinucleotides within the Rik23 and Tnrc5 CpG islands are shown (see Fig. 1 and SI Fig. 16). Colors indicate methylation levels as described in the legend to Fig. 1. (B) Methylated CpG dinucleotides within the Ptcra enhancer were randomly distributed among individual clones analyzed by bisulfite sequencing. Bisulfite sequencing results obtained with three different primer pairs (-4.3 kb, -4.1 kb, and -3.9 kb) are shown in a clone-by-clone manner. Results are shown for HSC, MPP, CLP, and CMP. Methylated (filled circles) and unmethylated (open circles) CpG dinucleotides are shown for a number of independently sequenced templates (horizontal lines).

Bisulfite Sequencing.

Bisulfite treatment of isolated preimplantation embryos was carried out essentially as described (1). Bisulfite treatment of DNA from adult tissues or cultured cells was performed as described (2, 3) with modest modification. Briefly, 1-2 mg of presheared genomic DNA in 50 ml of TE was denatured by adding 5 ml of 3 M NaOH and incubated for 15-30 min at 37°C. For bisulfite treatment, we added 510 ml of 40.5% sodium bisulfite (final concentration 3.3 M) and 30 ml of 10 mM hydroquinone (final concentration 0.5 mM), followed by incubation for 8-16 h at 55°C. Desalting was carried out using QIAquick PCR purification kit (Qiagen), and the eluted DNA (in 50 ml of double distilled H2O) was desulfonated by treatment with 5.5 ml of 3 M NaOH for 15 min at 37°C. DNA was precipitated by the addition of 2 mg of yeast tRNA, 35 ml of 5 M ammonium acetate, pH 7, and 230 ml of ethanol. After centrifugation, the precipitated DNA pellet was resuspended in 50 ml of TE buffer and stored at -20°C until use.

Sequence-specific PCR of the bisulfite-treated DNA was performed by using primers specific to the murine Ptcra locus, Il12b enhancer and promoter, and Alb1 enhancer. PCR was carried out in a volume of 50 ml containing 1´ PCR buffer (Invitrogen), 2.5 mM MgCl2, 1 mM forward and reverse primers, 200 mM dNTPs, and 1 unit of TaqDNA polymerase (Invitrogen). Nested or seminested PCR was performed when the starting DNA was limiting. PCR conditions were: first PCR, 94°C 3 min, 94°C 1 min, 54°C 1 min, 72°C 3 min for 5 cycles, followed by 94°C 30 sec, 54°C 30 sec, 72°C 1 min for additional 25 cycles; second PCR, 94°C 30 sec, 55-56°C 30 sec, 72°C 30 sec for 30 cycles. The PCR fragments were cloned into the pCR 2.1 vector (Invitrogen) and transformed into DH5a E. coli cells. Miniprep plasmid DNA was verified by EcoRI restriction analysis and the positive clones were sequenced using M13 forward (-20) or reverse primers. DNA sequencing was performed by the UCLA Sequencing and Genotyping Core Facility and the University of Washington High-Throughput Genomics Unit.

Genomic Footprinting.

Cells (1 ´ 108) were treated with 0.1% DMS (Sigma-Aldrich) in 1 ml of growth media for 1 min at 37°C, followed by immediate rinse with 50 ml of ice-cold PBS. The cells were lysed by the addition of 3 ml of cell lysis buffer (1 mM Tris×HCl, pH7.5/400 mM NaCl/2 mM EDTA/0.2% SDS/0.2 mg/ml proteinase K). This mixture was incubated for 3-5 h at 37°C with periodic mixing. After phenol extraction and chloroform extraction, DNA was precipitated with isopropanol. As a control, DNA extracted from untreated ESC CCE cells was treated in vitro with 0.1% DMS as described (4). Briefly, DNA (100 mg) was treated with 2 ml of 10% DMS in a volume of 202 ml at room temperature for 2 min. The reaction was stopped by the addition of 50 ml of ice-cold DMS stop buffer (1.5 M sodium acetate, pH7.0/1 M 2-mercaptoethanol/100 mg/ml yeast tRNA), followed by the addition of 2.5 volumes of ethanol on dry ice. DNA was precipitated, air-dried, and resuspended in 200 ml of 1 M piperidine in double distilled H2O for 15 min at room temperature.

After DMS treatment, purified genomic DNA from each cell type was cleaved at all methylated guanines by incubation in 200 ml of 1 M piperidine for 30 min at 90°C. The piperidine was removed by lyophilization, and the cleaved DNA pellets were resuspended in 360 ml of TE buffer (10 mM Tris×HCl/1 mM EDTA, pH7.5). Residual piperidine was removed by two successive ethanol precipitations. The resulting DNA pellets were resuspended in double distilled H2O to final concentration of 1 mg/ml.

Chemically modified and cleaved DNA was amplified by LM-PCR as described in ref. 5 with the following modifications: 2 mg of DNA was used for first-strand synthesis, followed by 21-23 cycles of PCR amplification with a profile of 95°C for 1 min, 63°C for 2 min, and 76°C for 5 min plus 15 sec for each additional cycle. The labeling PCR consisted of two rounds of PCR with 95°C for 1 min, 68°C for 2 min, and 76°C for 10 min. The following primers complementary to the coding strand of the Ptcra gene were used: Primer T1, 5'-ATAGTGGGGTGAAGCTGGCATAAGA; Primer T2, 5'- ACTTTCCTGCCCTCTCCTGACCTTG; Primer T3, 5'- CTCTCCTGACCTTGCGCAAGGACCCAGGTT. The footprinting reactions were separated on 6% denaturing polyacrylamide gels and visualized on a Typhoon 9410 PhosphorImager (Amersham Pharmacia Biosciences).

Cells (2 ´ 105) were attached to coverslips, washed once in PBS, fixed for 10 min in cold 5% paraformaldehyde in PBS (0.05 g/ml), permeabilized and blocked for 20 min in PBS containing 10% FBS/0.1% saponin/0.2% Triton X-100. The cells were then incubated for 1 h with anti-Oct-3/4 monoclonal antibody (BD Transduction Laboratories) diluted 1:200 in block solution, or anti-SSEA-1 monoclonal antibody (Chemicon) diluted 1:50 in block solution. The cells were washed 3 times (5 min each) in PBS containing 0.2% Triton X-100, then incubated for 30 min with FITC-conjugated goat anti-mouse IgG (Jackson Immunoresearch, West Grove, PA) diluted 1:500 in block solution. The cells were washed as above and mounted in Vectashield with 0.1 mg/ml DAPI (Vector Vector Laboratories, Burlingame, CA). Slides were analyzed on a Leica Inverted Confocal Microscope. For flow cytometry, phycoerythrin (PE)-conjugated mouse anti-SSEA-1 (R&D Systems, Minneapolis, MN) was used and the staining protocol provided with the antibody was followed.

ChIP assays were performed as described in ref. 6. For quantitative real-time PCR, the ChIP samples were analyzed in duplicate with the iQTM SYBR Green Supermix (Bio-Rad, Hercules, CA), using iCycler iQTM Real-Time PCR Detection System (Bio-Rad). Primers were designed to amplify sequences every 1 kb through the 20 kb Ptcra locus and every 1-3 kb through the Il12b locus. All primers were tested for PCR efficiency as recommended by the manufacturer (Bio-Rad). A standard curve was prepared for each set of primers using serial titration of the input DNA. The relative amount of precipitated chromatin (% of INPUT) was calculated from primer-specific standard curves using the iCycler Data Analysis Software. The graph was plotted using Microsoft Excel. The following antibodies were used for the ChIP experiments: Ac-H3K9 (Upstate; catalog no. 06-942), 2Me-H3K4 (Upstate; catalog no. 07-030), 3Me-H3K4 (Upstate; catalog no. 07-473), 3Me-H3K27 (Upstate; catalog no. 07-449), histone H3 (Abcam; catalog no. ab1791-100), FoxD3 (Chemicon; catalog no. AB5687) and GST control antibodies (prepared by our laboratory).

2. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molloy PL, Paul CL (1992) Proc Natl Acad Sci 89:1827-1831.

3. Clark SJ, Harrison J, Paul C, Frommer M (1994) Nucleic Acids Res 22:2990-2997.

4. Maxam AM, Gilbert W (1980) Methods Enzymol 65:499-560.

5. Weinmann AS, Plevy SE, Smale ST (1999) Immunity 11:665-675.

6. Su RC, Brown KE, Saaber S, Fisher AG Merkenschlager M, Smale ST (2004) Nat Genet 36:502-506.

This detailed study by Jian Xu, Scott Pope, Ali Jazirehi, Joanne Attema, Peter Papathanasiou, Jason Watts, Kenneth Zaret, Irving Weissman, and Stephen Smale reveals several new aspects of the relationships between gene enhancers and gene promoters during RNA synthesis in mouse embryonic stem cells. These relationships include those involving noncoding RNAs and their effects on epigenetic marking that permit both self-renewal and accurate pluripotent cell differentiation for embryonic organ formation.

1. Kapranov P, Cheng J, Dike S, Nix DA, Duttagupta R, Willingham AT, Stadler PE, Hertel J,  Hackermüller J, Hofacker IL, Bell I, Cheung E, Drenkow J, Dumais E, Patel S, Helt G, Ganesh M, Ghosh S,  Piccolboni A, Sementchenko V, Tammana H, and Gingeras TR,
"RNA Maps Reveal New RNA Classes and a Possible Function for Pervasive Transcription".

2. Tufarelli C, "The silence RNA keeps: cis mechanisms of RNA mediated epigenetic silencing in mammals".

1. Hosen N, Park CY, Tatsumi N, Oji Y, Sugiyama H, Gramatzki M, Krensky AM, and Weissman IL,
"CD96 is a leukemic stem cell-specific marker in human acute myeloid leukemia".

2. Stubbs MC, and Armstrong SA, "Therapeutic Implications of Leukemia Stem Cell Development".

3. Palmer MB, Majumder P, Green MR, Wade PA, and Boss JM,
"A 3' Enhancer Controls Snail Expression in Melanoma Cells".

4. Frenster JH, and Hovsepian JA, "Embryonic Gene Re-expression May Initiate Adult Neoplasms".

5. Kapranov P, Cheng J, Dike S, Nix DA, Duttagupta R, Willingham AT, Stadler PE, Hertel J,  Hackermüller J, Hofacker IL, Bell I, Cheung E, Drenkow J, Dumais E, Patel S, Helt G, Ganesh M, Ghosh S,  Piccolboni A, Sementchenko V, Tammana H, and Gingeras TR,
"RNA Maps Reveal New RNA Classes and a Possible Function for Pervasive Transcription".

6. DeCarvalho S, "Effect of RNA from Normal Human Marrow on Leukaemic Marrow In-Vivo".

7. Frenster JH, "Electron Microscopic Localization of Acridine Orange Binding to DNA within Human Leukemic Bone Marrow Cells", Cancer Research, Vol. 31, 1128-1133 (August, 1971).

8. Frenster JH, "Oncogenes as Molecular Targets within Active Chromatin", in: AACR-NCI-EORTC International Conference: "Molecular Targets and Cancer Therapeutics: Discovery, Development, and Clinical Validation", Washington, DC, November 16-19, 1999, and Published in: Clinical Cancer Research, vol. 5, suppl. l, p. 3855s, (624), (November, 1999).

9. Frenster JH, and Hovsepian JA,
"DNA-DNA Tetraplex Model of Paired Sense-Antisense RNA Synthesis".
 

Links to RNA and Biological Causality:

Links to Euchromatin Activator RNA Reviews:
Links to Euchromatin Activator RNA Research:
Links to Ultrastructural Probes of DNase I-Sensitive Sites:
Links to RNA as a Therapeutic Agent:
Links to Hodgkin Lymphoma Immuno-Pathology:
Links to Activated T-Lymphocyte Immunotherapy:
Links to Medical Systems Biology:
Links to Selective Gene Transcription:
Links to RNA-Induced Epigenetics:
Links to RNA-Induced Embryogenesis:
Links to RNA and Biological Causality:
Links to Reprogramming and Neoplasia:

A Brief History of Activator RNA:

"Ultrastructural Probes of Active DNA Sites, and the RNA Activators of DNA". (PowerPoint Presentation).